circad | circRNAs associated with diseases

hsa_circ_0000885
Gene	INSR	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Osteosarcoma	ICD-10	#N/A (C41)
DBLink	Link to database	PMID	30802235
Experimental Method
Sample Type	Serum and tissue samples	Comparison	n/a
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ACTGCCAGAAAGTGTGTCCC Reverse CGGGCCTCGTTTTGAACATC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Zhu, K, Niu, L, Wang, J, Wang, Y, Zhou, J, Wang, F, Cheng, Y, Zhang, Q, Li, H (2019). Circular RNA hsa_circ_0000885 Levels are Increased in Tissue and Serum Samples from Patients with Osteosarcoma. Med. Sci. Monit., 25:1499-1505.